ID: 1119983037_1119983045

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1119983037 1119983045
Species Human (GRCh38) Human (GRCh38)
Location 14:79103510-79103532 14:79103535-79103557
Sequence CCAGCAGAACATTCTAAATTTTG CTGGAGTTCGGGAGGGAAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 246} {0: 1, 1: 0, 2: 2, 3: 21, 4: 341}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!