ID: 1120009969_1120009973

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1120009969 1120009973
Species Human (GRCh38) Human (GRCh38)
Location 14:79402673-79402695 14:79402692-79402714
Sequence CCACCATTGAAGAATTAGATCTC TCTCAAACTAAAGGGATTGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 130} {0: 1, 1: 0, 2: 2, 3: 23, 4: 636}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!