ID: 1120024780_1120024783

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1120024780 1120024783
Species Human (GRCh38) Human (GRCh38)
Location 14:79570548-79570570 14:79570572-79570594
Sequence CCTGAGATGCTGACTGTGCAAGG TGTTCAGACCCAGTCAGGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 170} {0: 1, 1: 0, 2: 1, 3: 9, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!