ID: 1120025973_1120025977

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1120025973 1120025977
Species Human (GRCh38) Human (GRCh38)
Location 14:79584655-79584677 14:79584692-79584714
Sequence CCCAGCTACTGCTATGGGTACAG GGGCTCAGCTGACCACCTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 101} {0: 1, 1: 1, 2: 1, 3: 21, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!