ID: 1120036795_1120036807

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1120036795 1120036807
Species Human (GRCh38) Human (GRCh38)
Location 14:79706950-79706972 14:79706993-79707015
Sequence CCTGTCTATTCTCATTCGTTTGT CCTACGGGTGGTGCTGAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 25, 3: 35, 4: 208} {0: 1, 1: 17, 2: 29, 3: 51, 4: 814}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!