ID: 1120082024_1120082027

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1120082024 1120082027
Species Human (GRCh38) Human (GRCh38)
Location 14:80227519-80227541 14:80227557-80227579
Sequence CCAGGAACAGGCAAAGAGCTGTC AGTTATCTGCAGAAGATGGCAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 177, 3: 213, 4: 293} {0: 185, 1: 187, 2: 104, 3: 111, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!