|
Left Crispr |
Right Crispr |
Crispr ID |
1120107980 |
1120107987 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
14:80517936-80517958
|
14:80517978-80518000
|
Sequence |
CCAGATCCAGAGGGGTGGAAGTC |
CAGCAAACAGCAGTGGTGGACGG |
Strand |
- |
+ |
Off-target summary |
{0: 28, 1: 72, 2: 82, 3: 94, 4: 145} |
{0: 29, 1: 90, 2: 112, 3: 84, 4: 319} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|