ID: 1120107980_1120107987

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1120107980 1120107987
Species Human (GRCh38) Human (GRCh38)
Location 14:80517936-80517958 14:80517978-80518000
Sequence CCAGATCCAGAGGGGTGGAAGTC CAGCAAACAGCAGTGGTGGACGG
Strand - +
Off-target summary {0: 28, 1: 72, 2: 82, 3: 94, 4: 145} {0: 29, 1: 90, 2: 112, 3: 84, 4: 319}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!