ID: 1120128768_1120128770

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1120128768 1120128770
Species Human (GRCh38) Human (GRCh38)
Location 14:80780397-80780419 14:80780414-80780436
Sequence CCTTAAGGGTAAATTGTTTGGTT TTGGTTTCACAGGAAACTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 135} {0: 1, 1: 0, 2: 4, 3: 13, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!