ID: 1120176928_1120176939

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1120176928 1120176939
Species Human (GRCh38) Human (GRCh38)
Location 14:81304411-81304433 14:81304464-81304486
Sequence CCAAGCTCACGCTGTTAGAGATG TGTAATCCTAGCACTTTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 93} {0: 22138, 1: 313177, 2: 258607, 3: 141974, 4: 131406}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!