ID: 1120197614_1120197616

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1120197614 1120197616
Species Human (GRCh38) Human (GRCh38)
Location 14:81502740-81502762 14:81502759-81502781
Sequence CCTTCCTCAGTCAGCTTCTCAAA CAAACATCTCTCTCGCTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 53, 4: 745} {0: 1, 1: 0, 2: 0, 3: 6, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!