ID: 1120524230_1120524233

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1120524230 1120524233
Species Human (GRCh38) Human (GRCh38)
Location 14:85559274-85559296 14:85559290-85559312
Sequence CCTGAAAACAGAGTAGAAGAGGG AAGAGGGGCCCTTTCTCCTTCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 20, 4: 312} {0: 1, 1: 0, 2: 3, 3: 20, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!