ID: 1120526865_1120526870

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1120526865 1120526870
Species Human (GRCh38) Human (GRCh38)
Location 14:85587162-85587184 14:85587203-85587225
Sequence CCTTGAAAACCTACACACATACA CTTTTAGTATTTCAGGAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 60, 4: 1069} {0: 1, 1: 0, 2: 0, 3: 22, 4: 262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!