ID: 1120579047_1120579050

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1120579047 1120579050
Species Human (GRCh38) Human (GRCh38)
Location 14:86223545-86223567 14:86223565-86223587
Sequence CCTAATATTCTATCTTCATACAC CACACCCCAGGGCCTTCTGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 9, 3: 249, 4: 2639}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!