ID: 1120751242_1120751246

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1120751242 1120751246
Species Human (GRCh38) Human (GRCh38)
Location 14:88200442-88200464 14:88200474-88200496
Sequence CCCAGCTACGTGTGTACCTAATT ATAAAAAGAAAATGGAGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 58} {0: 1, 1: 0, 2: 16, 3: 313, 4: 3167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!