ID: 1120772419_1120772425

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1120772419 1120772425
Species Human (GRCh38) Human (GRCh38)
Location 14:88395142-88395164 14:88395193-88395215
Sequence CCATATACCCTGTACTCTGCTCT GTGGTATAGTTATCAAAACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 247} {0: 1, 1: 0, 2: 5, 3: 31, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!