ID: 1120800153_1120800156

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1120800153 1120800156
Species Human (GRCh38) Human (GRCh38)
Location 14:88678950-88678972 14:88678980-88679002
Sequence CCGTTGTGAAAGTTCTTGGGAAT CCTTGTTTCTCTCTAGCTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 242} {0: 1, 1: 1, 2: 12, 3: 71, 4: 430}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!