ID: 1120850203_1120850212

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1120850203 1120850212
Species Human (GRCh38) Human (GRCh38)
Location 14:89162887-89162909 14:89162929-89162951
Sequence CCTCCTTGGGGTCTCCGCTGACC GCTCACTCTCAGTCCGCATCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 167} {0: 1, 1: 1, 2: 1, 3: 5, 4: 53}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!