ID: 1120858777_1120858782

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1120858777 1120858782
Species Human (GRCh38) Human (GRCh38)
Location 14:89235745-89235767 14:89235760-89235782
Sequence CCTGACCCGCTGTGGTTGTCTGT TTGTCTGTGAAGATGGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 96} {0: 1, 1: 3, 2: 48, 3: 372, 4: 1097}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!