ID: 1120881589_1120881592

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1120881589 1120881592
Species Human (GRCh38) Human (GRCh38)
Location 14:89418122-89418144 14:89418157-89418179
Sequence CCAACAGGACACCCTGGTGGTGA TGTGATTGCACATTACTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 167} {0: 1, 1: 0, 2: 1, 3: 14, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!