ID: 1120886535_1120886544

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1120886535 1120886544
Species Human (GRCh38) Human (GRCh38)
Location 14:89456219-89456241 14:89456250-89456272
Sequence CCACAAAAGAGCCCGTGGGCCCT AAGGCTTTCATATTAGGGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 107} {0: 1, 1: 0, 2: 1, 3: 14, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!