ID: 1120897160_1120897165

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1120897160 1120897165
Species Human (GRCh38) Human (GRCh38)
Location 14:89543893-89543915 14:89543939-89543961
Sequence CCAAAACCAATGGGGGTGGGGGG AAATATTAATGTTATGAAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 254} {0: 1, 1: 0, 2: 2, 3: 58, 4: 737}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!