ID: 1120963962_1120963971

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1120963962 1120963971
Species Human (GRCh38) Human (GRCh38)
Location 14:90151011-90151033 14:90151061-90151083
Sequence CCTTCTTCCTCCTGTTCACACTT CCCTGATTGTAAGTTTCCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 58, 4: 647} {0: 37, 1: 5915, 2: 8512, 3: 6824, 4: 4423}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!