ID: 1120977268_1120977269

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1120977268 1120977269
Species Human (GRCh38) Human (GRCh38)
Location 14:90259997-90260019 14:90260018-90260040
Sequence CCTAAAAGATAAGGAAAATTGTA TACCACCTGAAAATAGATGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 55, 4: 674} {0: 1, 1: 0, 2: 2, 3: 12, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!