ID: 1120979912_1120979921

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1120979912 1120979921
Species Human (GRCh38) Human (GRCh38)
Location 14:90280308-90280330 14:90280354-90280376
Sequence CCAGCCTCTGTGAGTGCCACGCA GGACTCCTGCGTGTCCTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 130} {0: 1, 1: 0, 2: 0, 3: 16, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!