ID: 1121023620_1121023634

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1121023620 1121023634
Species Human (GRCh38) Human (GRCh38)
Location 14:90598430-90598452 14:90598460-90598482
Sequence CCTTCTAGGCTCCTCTCTCCATC ATGGGGGTAAGGAGGGGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 72, 4: 517} {0: 1, 1: 0, 2: 6, 3: 144, 4: 1804}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!