ID: 1121039458_1121039463

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1121039458 1121039463
Species Human (GRCh38) Human (GRCh38)
Location 14:90733357-90733379 14:90733392-90733414
Sequence CCCGGCTCCTTCTCCTTCATCTG GAGCAAAGTCCAAAACACAAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 11, 3: 74, 4: 699} {0: 1, 1: 0, 2: 1, 3: 23, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!