ID: 1121088795_1121088807

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1121088795 1121088807
Species Human (GRCh38) Human (GRCh38)
Location 14:91167204-91167226 14:91167237-91167259
Sequence CCCTTCTCCCACCATACCCAGAG CCAGCCTGGTGGTCCTGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 370} {0: 1, 1: 0, 2: 3, 3: 32, 4: 344}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!