ID: 1121091575_1121091577

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1121091575 1121091577
Species Human (GRCh38) Human (GRCh38)
Location 14:91186619-91186641 14:91186666-91186688
Sequence CCATAAACAATGCTGTAATGAAC ATGCCCATGATGACTTTGTTAGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 11, 3: 56, 4: 298} {0: 1, 1: 0, 2: 0, 3: 15, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!