ID: 1121100837_1121100842

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1121100837 1121100842
Species Human (GRCh38) Human (GRCh38)
Location 14:91249050-91249072 14:91249083-91249105
Sequence CCTCACACATGCTTCACACAGAA CTGAGGTTCTAAATGACAAACGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 27, 4: 338} {0: 1, 1: 0, 2: 3, 3: 19, 4: 246}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!