ID: 1121109255_1121109261

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1121109255 1121109261
Species Human (GRCh38) Human (GRCh38)
Location 14:91301377-91301399 14:91301413-91301435
Sequence CCAGACTCCACCTGCCAAAACCT GCACATTAAGAATACAATAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 314} {0: 1, 1: 0, 2: 1, 3: 31, 4: 332}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!