ID: 1121145989_1121145994

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1121145989 1121145994
Species Human (GRCh38) Human (GRCh38)
Location 14:91582831-91582853 14:91582867-91582889
Sequence CCTCACTCTTCAATTGTTAGTGT TTGGATGCAGGACAGGAACATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 13, 3: 30, 4: 191} {0: 1, 1: 0, 2: 21, 3: 151, 4: 1074}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!