ID: 1121152859_1121152864

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1121152859 1121152864
Species Human (GRCh38) Human (GRCh38)
Location 14:91653524-91653546 14:91653547-91653569
Sequence CCACATGGCTGGGGAAGATCTCA CAATCATGGCAGAGGGTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 36, 3: 71, 4: 299} {0: 1, 1: 52, 2: 1377, 3: 2632, 4: 5122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!