ID: 1121161281_1121161291

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1121161281 1121161291
Species Human (GRCh38) Human (GRCh38)
Location 14:91743712-91743734 14:91743752-91743774
Sequence CCTTCTGCCTTCTGCATGGGAGG TCTGGAGGATGCAACAACACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 43, 4: 350} {0: 1, 1: 0, 2: 0, 3: 12, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!