ID: 1121186124_1121186128

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1121186124 1121186128
Species Human (GRCh38) Human (GRCh38)
Location 14:91971440-91971462 14:91971459-91971481
Sequence CCATCACCAGCTTTTGTATCCTA CCTATCAATACAAATCAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 159} {0: 1, 1: 0, 2: 1, 3: 6, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!