ID: 1121202274_1121202277

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1121202274 1121202277
Species Human (GRCh38) Human (GRCh38)
Location 14:92128299-92128321 14:92128320-92128342
Sequence CCAACATGGTGAAACTCCGTCTC TCTACCAAAAAGAATTAGCTGGG
Strand - +
Off-target summary {0: 2217, 1: 43404, 2: 134323, 3: 143939, 4: 91625} {0: 1, 1: 10, 2: 88, 3: 346, 4: 1994}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!