|
Left Crispr |
Right Crispr |
Crispr ID |
1121202274 |
1121202277 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
14:92128299-92128321
|
14:92128320-92128342
|
Sequence |
CCAACATGGTGAAACTCCGTCTC |
TCTACCAAAAAGAATTAGCTGGG |
Strand |
- |
+ |
Off-target summary |
{0: 2217, 1: 43404, 2: 134323, 3: 143939, 4: 91625} |
{0: 1, 1: 10, 2: 88, 3: 346, 4: 1994} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|