ID: 1121236429_1121236432

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1121236429 1121236432
Species Human (GRCh38) Human (GRCh38)
Location 14:92394488-92394510 14:92394516-92394538
Sequence CCAGCCACGCAGGAGAGTTTGAG AATGAGCTATGGTTATAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 179} {0: 1, 1: 0, 2: 0, 3: 5, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!