ID: 1121240591_1121240596

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1121240591 1121240596
Species Human (GRCh38) Human (GRCh38)
Location 14:92427311-92427333 14:92427337-92427359
Sequence CCAGGACCTGGCAGCACAGGCAT CAGTGTGGCCAGAGTAGAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 585} {0: 1, 1: 1, 2: 10, 3: 58, 4: 367}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!