ID: 1121254330_1121254334

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1121254330 1121254334
Species Human (GRCh38) Human (GRCh38)
Location 14:92520193-92520215 14:92520220-92520242
Sequence CCTAGGCCGTGGTTGTGGTCAAG GTTGTCTGTAAGTGACGTGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 114} {0: 1, 1: 0, 2: 0, 3: 4, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!