ID: 1121262628_1121262631

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1121262628 1121262631
Species Human (GRCh38) Human (GRCh38)
Location 14:92577486-92577508 14:92577515-92577537
Sequence CCATCTTCTCTGTTTTCACTTTG CGGCAGCAGCAGCAGCAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 104, 4: 965} {0: 2, 1: 3, 2: 40, 3: 230, 4: 997}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!