ID: 1121272066_1121272071

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1121272066 1121272071
Species Human (GRCh38) Human (GRCh38)
Location 14:92644393-92644415 14:92644439-92644461
Sequence CCTAGGAACATGCTTTTTTTTTT GGAAGAACTGCATTCCTTTCTGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 38, 3: 329, 4: 2492} {0: 1, 1: 0, 2: 9, 3: 86, 4: 412}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!