ID: 1121283117_1121283123

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1121283117 1121283123
Species Human (GRCh38) Human (GRCh38)
Location 14:92713687-92713709 14:92713721-92713743
Sequence CCAGGGATTGGAAGGATCCCCTT CAGCACCCACAGTTGGAGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 103} {0: 1, 1: 0, 2: 0, 3: 17, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!