ID: 1121314852_1121314862

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1121314852 1121314862
Species Human (GRCh38) Human (GRCh38)
Location 14:92954878-92954900 14:92954915-92954937
Sequence CCCCTCACCCAGTGGTATCCCAG CCCTCAGAACCCCTTATCTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 10, 4: 178} {0: 1, 1: 0, 2: 0, 3: 16, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!