ID: 1121337073_1121337080

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1121337073 1121337080
Species Human (GRCh38) Human (GRCh38)
Location 14:93083960-93083982 14:93084004-93084026
Sequence CCATCAAAGCCGGCAATTTCCCT TGTTGTCCCTGCCCCCAGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 117} {0: 1, 1: 0, 2: 2, 3: 19, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!