ID: 1121362500_1121362504

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1121362500 1121362504
Species Human (GRCh38) Human (GRCh38)
Location 14:93274439-93274461 14:93274466-93274488
Sequence CCATGAGATGCAAGGGAGTGAAC TATTGGAAACACTTTTCCAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 116} {0: 1, 1: 0, 2: 2, 3: 27, 4: 291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!