ID: 1121398848_1121398852

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1121398848 1121398852
Species Human (GRCh38) Human (GRCh38)
Location 14:93653812-93653834 14:93653833-93653855
Sequence CCCAACGGCATCTTCCCGCAGCT CTGTTCCAAAGCACGATCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 79} {0: 1, 1: 0, 2: 0, 3: 4, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!