ID: 1121502382_1121502394

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1121502382 1121502394
Species Human (GRCh38) Human (GRCh38)
Location 14:94448504-94448526 14:94448547-94448569
Sequence CCCCAAGAGAGAGCAGGGCCAGG CGAGAAGAAGATGTTTCCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 414} {0: 1, 1: 0, 2: 0, 3: 4, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!