ID: 1121510459_1121510465

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1121510459 1121510465
Species Human (GRCh38) Human (GRCh38)
Location 14:94509410-94509432 14:94509432-94509454
Sequence CCAGCCTCCTAGTCCTTTTTCGG GTCCTGGTCCTGCAGCCTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 142} {0: 1, 1: 0, 2: 3, 3: 30, 4: 301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!