ID: 1121526586_1121526591

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1121526586 1121526591
Species Human (GRCh38) Human (GRCh38)
Location 14:94623604-94623626 14:94623626-94623648
Sequence CCCACAGGTGGTCCATAAGGCTG GTGCTTGATGTATTTGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 13, 4: 94} {0: 1, 1: 0, 2: 3, 3: 29, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!