ID: 1121535112_1121535116

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1121535112 1121535116
Species Human (GRCh38) Human (GRCh38)
Location 14:94685836-94685858 14:94685856-94685878
Sequence CCTACAGGGGGGCCCAGCTGGAT GATTCCCCCACATTCCCAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 145} {0: 1, 1: 0, 2: 0, 3: 8, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!