ID: 1121602316_1121602320

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1121602316 1121602320
Species Human (GRCh38) Human (GRCh38)
Location 14:95214557-95214579 14:95214583-95214605
Sequence CCAGGGCTGATGTTGGAACTCCT CTCAAGCGACCCTGCCGCCATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 59, 4: 259} {0: 1, 1: 1, 2: 24, 3: 545, 4: 6532}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!